View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8563_low_17 (Length: 267)
Name: NF8563_low_17
Description: NF8563
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8563_low_17 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 158; Significance: 4e-84; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 18 - 251
Target Start/End: Complemental strand, 9027354 - 9027123
Alignment:
| Q |
18 |
gtgagaaaaagaggaagcacgctcataaaggtaaaaaacaaacaaatctcgacaactttaatttgtctttgttttgataaagacatacattgtttaatta |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
9027354 |
gtgagaaaaagaggaagcacgctcataaaggtaaaaaacaaacaaatctcgacaacttt-----gtctttgttttgataaagacatacattgtttaatta |
9027260 |
T |
 |
| Q |
118 |
atctatatacattttatcactacttcatgttttgcaaatgtatggctaatcatataatatgatatggtccctcnnnnnnntatatgatatgat---atat |
214 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| | | | ||||| |||| |
|
|
| T |
9027259 |
atctatatacattttatcactatttcatgttttgcaaatgtatggctaatcatataatatgatatggtccctcaaaaaaaaaaaaaaaatgatatgatat |
9027160 |
T |
 |
| Q |
215 |
gtatcattttcttttgcttatgtgtattccttgtttt |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9027159 |
gtatcattttcttttgcttatgtgtattccttgtttt |
9027123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University