View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8563_low_22 (Length: 248)
Name: NF8563_low_22
Description: NF8563
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8563_low_22 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 17 - 225
Target Start/End: Original strand, 43702981 - 43703189
Alignment:
| Q |
17 |
acatcagttctgtaagttccacttagcactcttgtgctcactttttaattctatagagaacaatgaacattaacagtgagactcaaataatgaacatcaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43702981 |
acatcagttctgtaagttccacttagcactcttgtgctcactttttaattctatagagaacaatgaacattaacagtgagactcaaataatgaacatcaa |
43703080 |
T |
 |
| Q |
117 |
cagttacacttatgcagagaaatttacaccaaagtttcatgttagacttgctttttgagcaaaataaaacatactttatttcactacaaagtttaaactt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43703081 |
cagttacacttatgcagagaaatttacaccaaagtttcatgttagacttgctttttgagcaaaataaaacatactttatttcactacaaagtttaaactt |
43703180 |
T |
 |
| Q |
217 |
ggttttatt |
225 |
Q |
| |
|
|||||||| |
|
|
| T |
43703181 |
tgttttatt |
43703189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University