View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8563_low_23 (Length: 243)
Name: NF8563_low_23
Description: NF8563
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8563_low_23 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 22 - 219
Target Start/End: Original strand, 43324241 - 43324439
Alignment:
| Q |
22 |
caaagtaaaattagtagccagaaatcaaggttgtgaacataaagcatgaactaagaatacttaatgttcaagacaaaactaatattggtattatgaatga |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43324241 |
caaagtaaaattagtagccagaaatcaaggttgtgaacataaagcatgaactaagaatacttgatgttcaagacaaaactaatattggtattatgaatga |
43324340 |
T |
 |
| Q |
122 |
agttcatgtttggaatcacggtg-ccgtcactccaaacatgccttagtaaaagcaagtcattgagttaattttgttaggtaaaaagaagatacatgaat |
219 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
43324341 |
agttcatggttggaatcacggtgaccgtcactccaaacatgccttagtaaaagcaagtcattgagttaattttgttaggtaaatagaagatacatgaat |
43324439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University