View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8563_low_25 (Length: 239)
Name: NF8563_low_25
Description: NF8563
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8563_low_25 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 1 - 215
Target Start/End: Original strand, 26562071 - 26562285
Alignment:
| Q |
1 |
agcttatgaaatgatcacatgcaaactgaaaataggaatacaaacattcattgaagtatttttgtttatacatgcctaggtgcctcgtccgtagcaaggc |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
26562071 |
agctcatgaaatgatcacatgcaaactgaaaataggaaaacaaacattcattgaagtatttttgtttatacatgcatgggtgcctcgtccgtagcaaggt |
26562170 |
T |
 |
| Q |
101 |
agtggttttggtgtccctgtggcacagcagggcgacttgcttgagcttttgcacgacatgaatgaataaacggtccgtatacgacaaaattgatgcacat |
200 |
Q |
| |
|
||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
26562171 |
ggtggttttggtgtccctatggcacgacagggcgacttgcttgagcttttgcacgacatgaatgaataaacggtccgtatacgacgaaattgatgcacat |
26562270 |
T |
 |
| Q |
201 |
cacatatatattggg |
215 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
26562271 |
cacatatatattggg |
26562285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University