View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8563_low_30 (Length: 209)
Name: NF8563_low_30
Description: NF8563
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8563_low_30 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 9 - 209
Target Start/End: Original strand, 1815228 - 1815423
Alignment:
| Q |
9 |
gagagatatatataatgcaatgcaagtaagttattacaaagactgtgtttgtgtttaaaaggtaaaacaaattaaaagaggtaagcttcttcgtgggaag |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
1815228 |
gagagatatatataatgcaatgcaagtaagttataacaaagactgtgtttgtgtttaaaaggtaaaacaaa-----agaggtaagcttcttcgtaggaag |
1815322 |
T |
 |
| Q |
109 |
gtacgtgagtggaaatatgctgtcagtgagagagcaatatatcgccacgtttacttgatttatgcattattgaatactatagtacattagtaattttgtg |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1815323 |
gtacgtgagtggaaatatgctgtcagtgagagagcaatatatcgccacgtttacttgatttatgcattattgaatactatagtacattagtaattttgtg |
1815422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University