View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8563_low_31 (Length: 201)
Name: NF8563_low_31
Description: NF8563
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8563_low_31 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 55; Significance: 8e-23; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 55; E-Value: 8e-23
Query Start/End: Original strand, 129 - 183
Target Start/End: Complemental strand, 30805725 - 30805671
Alignment:
| Q |
129 |
gatcatgaaacagttctgttccgacagtgttttgtactaggttttgggtaaaact |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30805725 |
gatcatgaaacagttctgttccgacagtgttttgtactaggttttgggtaaaact |
30805671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 15 - 67
Target Start/End: Complemental strand, 30805840 - 30805788
Alignment:
| Q |
15 |
gagatgaatacggcgtgcgtggaatgagatgtttctaagaagaatagaagtca |
67 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30805840 |
gagacgaatacggcgtgcgtggaatgagatgtttctaagaagaatagaagtca |
30805788 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University