View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8564_low_12 (Length: 239)
Name: NF8564_low_12
Description: NF8564
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8564_low_12 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 25 - 239
Target Start/End: Original strand, 7461925 - 7462146
Alignment:
| Q |
25 |
cttttatgagggagtgcttcaagataatgatcagatttagatgggaggttgcggattgaatgaagacgttgattatttacttgtta-----gatgtgnnn |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||| |||||||||||| |||||| |
|
|
| T |
7461925 |
cttttatgagggagtgcttcaagataatgatcagatttaaacgggaggttgcggattgaatgaagacgttgatcatttacttgttacgttagatgtgttt |
7462024 |
T |
 |
| Q |
120 |
nnnnaagcaatatttggtctttggttataaattgattaggttttattacattgcatcaagct--tatattttggctcattatgatatgtttaggagctta |
217 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
7462025 |
ttttaagcaatatttggtctttggttacaaattgattaggttttattacattgcatcaagcttatatattttggctcattatgatatgtttaggagctta |
7462124 |
T |
 |
| Q |
218 |
ggtggtttctctaaccaaactc |
239 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
7462125 |
ggtggtttctctaaccaaactc |
7462146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University