View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8565_high_12 (Length: 228)
Name: NF8565_high_12
Description: NF8565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8565_high_12 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 10 - 228
Target Start/End: Complemental strand, 34652016 - 34651798
Alignment:
| Q |
10 |
cacaagcatacgtataattatcaggccttatatcatccacaagcatggttctaaataaagaaattgcatagctgaatcttcgagccttggcaaaagctcg |
109 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
34652016 |
cacaagcatatgtataattatcaggccttatatcatccacaagcatggttctaaataaagaaattgcgttgctgaatcttcgagccttggcaaaagctcg |
34651917 |
T |
 |
| Q |
110 |
aatcatggaattccaaaggaaaacacttcgggtggaagttttgtcgaacacgtggtgtgcatagttaatgtgattgttaaatgcataaagtctaatgatt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34651916 |
aatcatggaattccaaaggaaaacacttcgggtggaagttttgtcgaacacgtggtgtgcatagttaatgtgattgttaaatgcataaagtctaatgatt |
34651817 |
T |
 |
| Q |
210 |
tgagtagcataaaaagggt |
228 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
34651816 |
tgagtagcataaaaagggt |
34651798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University