View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8565_high_7 (Length: 262)
Name: NF8565_high_7
Description: NF8565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8565_high_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 177; Significance: 2e-95; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 8 - 247
Target Start/End: Complemental strand, 39543743 - 39543501
Alignment:
| Q |
8 |
aagcagagaactcaacaacatgcagtcacttgccaactcaaacaat---ggtggtagttccaaacgctcaaaactcgaatccttttctgccttcttgtgg |
104 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
39543743 |
aagcaaagaactcaacaacatgcagtcacttgccaactcaaacaataatggtggtagttccaaacgctcaaaactcgagtccttttctgctttcttgtgg |
39543644 |
T |
 |
| Q |
105 |
aaaatggttgccgcagcgacttcaatcaataatgaaaacattgttgcaaaaatggggattgtggttgacgggagaaagagactaagcaacggagacaaac |
204 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||| |||||||||||||||||| ||||||||||||| |||||||| ||||||||||| |||||| |
|
|
| T |
39543643 |
aaaatggttgccgaagcggcttcaatcaataatgaaaatattgttgcaaaaatggggcttgtggttgacggaagaaagaggctaagcaacggtgacaaaa |
39543544 |
T |
 |
| Q |
205 |
acaaagacgagattatgaattcatattttgggaatgtgctttc |
247 |
Q |
| |
|
||||||| ||| ||||||||||||||||||||||||||||||| |
|
|
| T |
39543543 |
acaaagaagagcttatgaattcatattttgggaatgtgctttc |
39543501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 8 - 247
Target Start/End: Complemental strand, 39553762 - 39553520
Alignment:
| Q |
8 |
aagcagagaactcaacaacatgcagtcacttgccaactcaaacaat---ggtggtagttccaaacgctcaaaactcgaatccttttctgccttcttgtgg |
104 |
Q |
| |
|
||||| |||||||||||||||||||||||| ||||||||||||||| |||||||||||||| |||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
39553762 |
aagcaaagaactcaacaacatgcagtcactagccaactcaaacaataatggtggtagttccaagcgctcaaaactcgagtccttttctgctttcttgtgg |
39553663 |
T |
 |
| Q |
105 |
aaaatggttgccgcagcgacttcaatcaataatgaaaacattgttgcaaaaatggggattgtggttgacgggagaaagagactaagcaacggagacaaac |
204 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||| |||||||||||||||||| ||||||||||||| |||||||| ||||||||||| |||||| |
|
|
| T |
39553662 |
aaaatggttgccgaagcggcttcaatcaataatgaaaatattgttgcaaaaatggggcttgtggttgacggaagaaagaggctaagcaacggtgacaaaa |
39553563 |
T |
 |
| Q |
205 |
acaaagacgagattatgaattcatattttgggaatgtgctttc |
247 |
Q |
| |
|
||||||| ||| ||||||||||||||||||||||||||||||| |
|
|
| T |
39553562 |
acaaagaagagcttatgaattcatattttgggaatgtgctttc |
39553520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 14 - 247
Target Start/End: Complemental strand, 39586860 - 39586627
Alignment:
| Q |
14 |
agaactcaacaacatgcagtcacttgccaactcaaacaatggtggtagttccaaacgctcaaaactcgaatccttttctgccttcttgtggaaaatggtt |
113 |
Q |
| |
|
||||||||||| |||||||| ||| |||||| |||| ||| |||| || || ||||||||||| ||||| |||||||| |||||||||||||||||| |
|
|
| T |
39586860 |
agaactcaacaccatgcagttactagccaacacaaataatagtggaagcgttaagcgctcaaaacttgaatcgttttctgctttcttgtggaaaatggtt |
39586761 |
T |
 |
| Q |
114 |
gccgcagcgacttcaatcaataatgaaaacattgttgcaaaaatggggattgtggttgacgggagaaagagactaagcaacggagacaaacacaaagacg |
213 |
Q |
| |
|
|| |||| |||||| ||||| |||||| ||||||||||||||||||||||||||||||| ||||||||| |||||||||| |||||| ||||||| | |
|
|
| T |
39586760 |
gcatcagccgcttcaaccaatagtgaaaatgttgttgcaaaaatggggattgtggttgacggaagaaagagattaagcaacggtgacaaaaacaaagaag |
39586661 |
T |
 |
| Q |
214 |
agattatgaattcatattttgggaatgtgctttc |
247 |
Q |
| |
|
|| |||||| ||| |||||||||||||||||||| |
|
|
| T |
39586660 |
agtttatgagttcgtattttgggaatgtgctttc |
39586627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University