View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8565_low_17 (Length: 226)
Name: NF8565_low_17
Description: NF8565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8565_low_17 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 33 - 210
Target Start/End: Complemental strand, 36100355 - 36100178
Alignment:
| Q |
33 |
ggctttatcttattttctgttgctatgtgctgcagaaccataaatttcctaggaggaatttctgtcacaaaatttcaaaccctgcattgcctaaaccgtt |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36100355 |
ggctttatcttattttctgttgctatgtgctgcagaaccataaatttcctaggaggaatttctgtcacaaaatttcaaaccctgcattgcctaaaccgtt |
36100256 |
T |
|
| Q |
133 |
tcttcagaattatggtaaacctcaaacattaatttatgaacaaaaatcaacaagactttctactggtgcatatagaac |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
36100255 |
tcttcagaattatggtaaacctcaaacattaatttatgaacaaaaatcaacaagactttctactggagcatatagaac |
36100178 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University