View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8565_low_5 (Length: 325)
Name: NF8565_low_5
Description: NF8565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8565_low_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 242; Significance: 1e-134; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 49 - 310
Target Start/End: Complemental strand, 45175834 - 45175573
Alignment:
| Q |
49 |
ataataatattaatattgactttgtggtgagagatttgcgttcacaattggctgttattccaaccactaacgatcacgatcacgatcacgatcatcaaca |
148 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
45175834 |
ataataatattaatattgacttggtggtgagagatttgcgttcacagttggctgttattccaaccactaacgatctcgatcacgatcacgatcatcaaca |
45175735 |
T |
 |
| Q |
149 |
atctctcttcaacttgaatcatatcaaagtccctaccaacaccgtcttctttccttcttctatggatccaaacaaaaaggtaatttcttctctctttctt |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45175734 |
atctctcttcaacttgaatcatatcaaagtccctaccaacaccgtcttctttccttcttcaatggatccaaacaaaaaggtaatttcttctctctttctt |
45175635 |
T |
 |
| Q |
249 |
tattctttgattcatacttttattggtttggatgaatttcatcgcatttcttttaacacagg |
310 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
45175634 |
tattctttgattcatacttttattggattggatgaatttcatcgcatttcttttaacacagg |
45175573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 21 - 57
Target Start/End: Complemental strand, 45175877 - 45175841
Alignment:
| Q |
21 |
cagcaacagcaacagcaacatagcaatgataataata |
57 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
45175877 |
cagcagcagcaacatcaacatagcaatgataataata |
45175841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University