View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8565_low_8 (Length: 274)
Name: NF8565_low_8
Description: NF8565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8565_low_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 148; Significance: 4e-78; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 1 - 244
Target Start/End: Complemental strand, 29136349 - 29136108
Alignment:
| Q |
1 |
agtcagagattgtactactgaccacctacttaaggtgcccgagtctcttaccacttggatcgaccacacgatgttgctaacttgtgctttacttagacnn |
100 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
29136349 |
agtcagagattgaactactgaccacctacttaaggtgctcgagtctcttaccacttggatcgac-acacgatgttgctaacttgtgctttacttagacaa |
29136251 |
T |
 |
| Q |
101 |
nnnnnnnnnnnnnnnnnnttgactcaaaacaacactaatttaatttgactgacttgtttattccaccccaacaacctaaagttgaactctttctatccct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29136250 |
aaaaaaagaaaaaaaa--ttgactcaaaacaacactaatttaatttgactgacttgtttattccaccccaacaacctaaagttgaactctttctatccct |
29136153 |
T |
 |
| Q |
201 |
tcaaataatttattaccatcac-aagtgtaatcacaagtataatc |
244 |
Q |
| |
|
|||||||||||||||||||||| ||| |||||||||||| ||||| |
|
|
| T |
29136152 |
tcaaataatttattaccatcacaaagcgtaatcacaagtttaatc |
29136108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University