View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8565_low_9 (Length: 262)
Name: NF8565_low_9
Description: NF8565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8565_low_9 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 27 - 262
Target Start/End: Original strand, 49019511 - 49019742
Alignment:
| Q |
27 |
cacttaacaaaaataaatgttgcatatcataatcctactcacttcattatgcctacaatcatgattcttggttccatcacccgcatgctcttttctaaac |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49019511 |
cacttaacaaaaataaatgttgcatatcataatcctactcacttcattatgcctacaatcatgattcttggttccatcacccgcatgctcttttctaaac |
49019610 |
T |
|
| Q |
127 |
actctcacacttcttcttcttaatactctcattcttattcatacacacctataaatctcattcannnnnnnaatcctttctctcacttcaacctcaacat |
226 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
49019611 |
actctcaca---cttcttcttaatactctcattcttattcatacacacctataaatctcattca-ccccccaatcctttctctcacttcaacctcaacat |
49019706 |
T |
|
| Q |
227 |
ttcaatcaaatattactctcaactcctctgtttttc |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
49019707 |
ttcaatcaaatattactctcaactcctctgtttttc |
49019742 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 44 - 122
Target Start/End: Complemental strand, 7082253 - 7082175
Alignment:
| Q |
44 |
tgttgcatatcataatcctactcacttcattatgcctacaatcatgattcttggttccatcacccgcatgctcttttct |
122 |
Q |
| |
|
|||||||||||||||||| | ||||||||||||||| | ||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
7082253 |
tgttgcatatcataatcccattcacttcattatgcccaaaatcatgattcttggtttcatcacccgcatgctctcttct |
7082175 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University