View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8566_high_25 (Length: 242)
Name: NF8566_high_25
Description: NF8566
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8566_high_25 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 111 - 233
Target Start/End: Complemental strand, 23788314 - 23788192
Alignment:
| Q |
111 |
tgtagcaacaagacaaatatttgaagaaataccctcgaacaatattacaagtgaatgcaacgattcttattccaagggatatactctgcaacattgaaat |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23788314 |
tgtagcaacaagacaaatatttgaagaaataccctcgaacaatattacaagtcaatgcaacgattcttattccaagggatatactctgcaacattgaaat |
23788215 |
T |
 |
| Q |
211 |
caattttggcctacagtataatc |
233 |
Q |
| |
|
||||||||||||||||| ||||| |
|
|
| T |
23788214 |
caattttggcctacagtctaatc |
23788192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 148 - 217
Target Start/End: Complemental strand, 34725449 - 34725380
Alignment:
| Q |
148 |
aacaatattacaagtgaatgcaacgattcttattccaagggatatactctgcaacattgaaatcaatttt |
217 |
Q |
| |
|
||||||| ||||||| ||||||| | ||||||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
34725449 |
aacaatagtacaagtcaatgcaatggctcttattccaagggatatactctgcaatgttcaaatcaatttt |
34725380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University