View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8566_low_21 (Length: 319)
Name: NF8566_low_21
Description: NF8566
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8566_low_21 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 50; Significance: 1e-19; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 6 - 75
Target Start/End: Original strand, 14570503 - 14570572
Alignment:
| Q |
6 |
atcaattcctttacctatgaaaatcaatacttatatctgtaaacattaatataatgttattttgcgtacc |
75 |
Q |
| |
|
|||||||| ||||||||| ||||||| |||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
14570503 |
atcaattcttttacctatcaaaatcactacttatatctgcaaacattaatataatgttattttacgtacc |
14570572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 245 - 305
Target Start/End: Original strand, 14570743 - 14570803
Alignment:
| Q |
245 |
ttttcgtacatctgtcttttactgtttcacatgtaagtattcgtaaatagctcataacctg |
305 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||| |||||| ||||||||||| |
|
|
| T |
14570743 |
ttttcgtacatctgtgttttactgtttcacatgtaagtattcataaataactcataacctg |
14570803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 139 - 172
Target Start/End: Original strand, 14570637 - 14570670
Alignment:
| Q |
139 |
ctcaatcaattcttacgaactatgtacaaacaaa |
172 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
14570637 |
ctcaatcaaatcttacgaactatgtacaaacaaa |
14570670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 49; Significance: 5e-19; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 245 - 305
Target Start/End: Original strand, 19782730 - 19782790
Alignment:
| Q |
245 |
ttttcgtacatctgtcttttactgtttcacatgtaagtattcgtaaatagctcataacctg |
305 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
19782730 |
ttttcgtacatctgtgttttactgtttcgcatgtaagtattcataaatagctcataacctg |
19782790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 6 - 75
Target Start/End: Original strand, 19782490 - 19782559
Alignment:
| Q |
6 |
atcaattcctttacctatgaaaatcaatacttatatctgtaaacattaatataatgttattttgcgtacc |
75 |
Q |
| |
|
||||| ||||||| |||| ||||||| |||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
19782490 |
atcaactcctttatctatcaaaatcactacttatatctgcaaacattaatataatgttattttacgtacc |
19782559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 139 - 172
Target Start/End: Original strand, 19782624 - 19782657
Alignment:
| Q |
139 |
ctcaatcaattcttacgaactatgtacaaacaaa |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
19782624 |
ctcaatcaattcttacgaactatgtacaaacaaa |
19782657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University