View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8566_low_23 (Length: 298)
Name: NF8566_low_23
Description: NF8566
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8566_low_23 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 18 - 273
Target Start/End: Complemental strand, 31312297 - 31312042
Alignment:
| Q |
18 |
gataaaaggtttgtattgtgtgtgttagtgtttgcaacaatagtgcaattgattttgactgatgctggtattcgtcttgcagttactttagcttgtgctg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31312297 |
gataaaaggtttgtattgtgtgtgttagtgtttgcaacaatagtgcaattgattttgactgatgctggtattcgtcttgcagttactttagcttgtgctg |
31312198 |
T |
|
| Q |
118 |
tgcctttggttttggtgcatgcagttttatgggttagtcactatggttttgaggttgaggatgtttcttgttgttgttgtaacaaagaattggctccact |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31312197 |
tgcctttggttttggtgcatgcagttttatgggttagtcactatgtttttgaggttgaggatgtttcttgttgttgttgtaacaaagaattggctccact |
31312098 |
T |
|
| Q |
218 |
agttggtcatagtgagtttggaggtgatggcctagaaaatgtttgatttttctgtg |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31312097 |
agttggtcatagtgagtttggaggtgatggcctagaaaatgtttgatttttctgtg |
31312042 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University