View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8566_low_29 (Length: 248)
Name: NF8566_low_29
Description: NF8566
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8566_low_29 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 29 - 248
Target Start/End: Original strand, 43961206 - 43961425
Alignment:
| Q |
29 |
tctctttctcttacaacgttaattgaatgtcaactacatgatcaagacacttgnnnnnnnaacagaaaacaatgtagtacttagtattatttttcatccg |
128 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43961206 |
tctctctctcttacaacgttaattgaatgtcaactacatgatcaagacacttgtttttttaacagaaaacaatgtagtacttagtattatttttcatccg |
43961305 |
T |
 |
| Q |
129 |
actcaggtggatggtagcaactttgactgatttttatatcaacgttatcattttaagtgtaagttaaccaactacttaactctctataatcttcttcact |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43961306 |
actcaggtggatggtagcaactttgactgatttttatatcaacgttatcattttaagtgtaagttaaccaactacttaactctctataatcttcttcact |
43961405 |
T |
 |
| Q |
229 |
atttttgcgatttttgtttc |
248 |
Q |
| |
|
||||||| |||||||||||| |
|
|
| T |
43961406 |
atttttgtgatttttgtttc |
43961425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University