View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8566_low_39 (Length: 222)
Name: NF8566_low_39
Description: NF8566
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8566_low_39 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 7 - 222
Target Start/End: Complemental strand, 36060121 - 36059910
Alignment:
| Q |
7 |
tacattttatttttagaatttgaagaagaaacatctataaaagttcaataagtgccatactcaccaacattgcccacttatgaagacacttagagtgaaa |
106 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36060121 |
tacattttatttttagaa-----agaagaaacatctatagaagttcaataagtgccatactcaccaacattgcccacttatgaagacacttagagtgaaa |
36060027 |
T |
|
| Q |
107 |
ggatcatgatacatataggaagtcttcaacatctctttgacaatgcagaagccttatcaccattaatacttgaagatctctat-gaaaaaactgagaaat |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||| |||||||| |
|
|
| T |
36060026 |
ggatcatgatacatataggaagtcttcaacatctctttgacaatgcagaagccttatcaccatgaatacttgaagatctctataaaaaaaattgagaaat |
36059927 |
T |
|
| Q |
206 |
aaaagccaaaatgatat |
222 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
36059926 |
aaaagccaaaatgatat |
36059910 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University