View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8566_low_9 (Length: 422)
Name: NF8566_low_9
Description: NF8566
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8566_low_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 353; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 353; E-Value: 0
Query Start/End: Original strand, 16 - 411
Target Start/End: Complemental strand, 36356654 - 36356258
Alignment:
| Q |
16 |
caattagtggagcgttgcggtaa-tttagacaatttctttttccaccctccgcatctaattcatattatgaggattatatgatctaaaatgttgtaaagt |
114 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
36356654 |
caattagttgagcgttgcggtaactttagacaatttctttttccaccctccacatctaattcatattatgaggattatatgatcgaaaatgttgtaaagt |
36356555 |
T |
|
| Q |
115 |
gcgcgagaaactagtaagatgaatgatcaatatattgcatacactcactttgtacatgaattatcacatgttggagtttaatatttgaacatcacttgta |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
36356554 |
gcgcgagaaactagtaagatgaatgatcaatatattgcatacactcactttgtccatgaattatcacacgttggagtttaatatttgaacatcacttgta |
36356455 |
T |
|
| Q |
215 |
ggatgttgcttaacaatcacatgatttatttgcagcagttaatgtttatctgatttgtgtgagtgcatgtgcaggctatacatgggcttggagcaagaaa |
314 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36356454 |
tgattttgcttaacaatcacatgatttatttgcagcagttaatgtttatctgatttgtgtgagtgcatgtgcaggctatacatgggcttggagcaagaaa |
36356355 |
T |
|
| Q |
315 |
gttttctttagttggattaagccttctaggttgcgttccacatgaaatttctacccatgggaaaaatgactcaagatgtattcaagaggagaataat |
411 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
36356354 |
gttttctttagttggattaagccttctaggttgcgttccacatgaaatttctacccatgggaaaaatgattcaaggtgtattcaagaggagaataat |
36356258 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University