View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8567_low_8 (Length: 250)
Name: NF8567_low_8
Description: NF8567
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8567_low_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 8 - 232
Target Start/End: Complemental strand, 37827026 - 37826802
Alignment:
| Q |
8 |
tcagcggcaaccgactcaatccaattcatcacccaccactgtgaagtcacaaatcgaaaagtaaccgaccaccgtggttgtgcctatagtggtttttaga |
107 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37827026 |
tcagcggcaactgactcaatccaattcatcacccaccactgtgaagtcacaaatcgaaaagtaaccgaccaccgtggttgtgcctatagtggtttttaga |
37826927 |
T |
 |
| Q |
108 |
accaaaacgaaaagtacaaatgtgaaacggtgcgaaccaccaaagcacattttgtaatagaaccaacaagatccggcaatgaatcttcaaggtggcgacg |
207 |
Q |
| |
|
|||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37826926 |
accaaaacaaaaagtacaaatgtgaaacagtgcgaaccaccaaagcacattttgtaatagaaccaacaagatccggcaatgaatcttcaaggtggcgacg |
37826827 |
T |
 |
| Q |
208 |
ttgtagcaagatgttcgtcgtcgtt |
232 |
Q |
| |
|
| |||||||| |||||||||||||| |
|
|
| T |
37826826 |
tcgtagcaaggtgttcgtcgtcgtt |
37826802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University