View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8568_high_5 (Length: 246)

Name: NF8568_high_5
Description: NF8568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8568_high_5
NF8568_high_5
[»] chr5 (1 HSPs)
chr5 (24-225)||(32346376-32346571)


Alignment Details
Target: chr5 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 24 - 225
Target Start/End: Complemental strand, 32346571 - 32346376
Alignment:
24 gatacagaagagagaaaaaatttcaactgtaaacaatgctcgccgctgcttcgaggcacgccaggtacacacccggcagcaacaaccgtgtccggtcact 123  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
32346571 gatacagaagagagaaaaaatttcaactgtaaacaatgctcgccgctgcttcgaggcacgccaggtacacacccggccgcaacaaccgtgtccggtcact 32346472  T
124 cttaaacgcttccggcatcaccaccggttactcaattcccacttcaaacggaatcagttacagttacagttacagttacagtaacctcaacaccagaact 223  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||      ||||||||||||||||||||||    
32346471 cttaaacgcttccggcatcaccaccggttactcaattcccacttcaaatggaatcagttacagttacagtta------cagtaacctcaacaccagaact 32346378  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University