View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8568_low_13 (Length: 221)
Name: NF8568_low_13
Description: NF8568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8568_low_13 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 11369982 - 11370202
Alignment:
| Q |
1 |
aagttgcattttttgacgaaatttgacacattaggtgcagggattgatgtgttgttttcgaaaacgggtgtaccagtaacacttgagttttgcaaattag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
11369982 |
aagttgcattttttgacgaaatttgacacattaggtgcagggattgatgtgttgttttcgaaaacgggtgtaccagtaccacttgagttttgcaaattag |
11370081 |
T |
|
| Q |
101 |
gtgttgttttattttatatgtagctgtcgggtcagttgggcatggagtttttgtcctctatgtttaagctctttatatctttgtatacttatactcttgt |
200 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11370082 |
gtgttgttttattttatatgtagccgtcgggtctgttgggcatggagtttttgtcctctatgtttaagctctttatatctttgtatacttatactcttgt |
11370181 |
T |
|
| Q |
201 |
ttacatttagacatttgtttt |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
11370182 |
ttacatttagacatttgtttt |
11370202 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University