View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8568_low_6 (Length: 287)
Name: NF8568_low_6
Description: NF8568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8568_low_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 165; Significance: 3e-88; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 38 - 270
Target Start/End: Original strand, 8048868 - 8049100
Alignment:
| Q |
38 |
tctttctcttggcaaaaccaacccatggaaaccagaatctcacctgattccgctgcgtcgaatggaaccaatccctcatcggattccgatgcgccaaaaa |
137 |
Q |
| |
|
||||||||| ||||||| ||||| |||||||||| |||||| | ||||||||||||||||||||||||||| |||| |||||||||||| |||||||| |
|
|
| T |
8048868 |
tctttctctcggcaaaaacaacctatggaaaccaacatctcatccgattccgctgcgtcgaatggaaccaattactcaccggattccgatgtgccaaaaa |
8048967 |
T |
 |
| Q |
138 |
ccaccatggaaaccaacacctcgtcagcattgcagaatttatgtgcgtcgaatggaacacaaacccattgtctgacttagacctcaacttgtatagaata |
237 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||| || ||||||||||||||||||||||||| |||||||||| |||||||||||||||| |
|
|
| T |
8048968 |
ccaccatggaaaccaacacctcatcagcattgcagaatttatatgtgtcgaatggaacacaaacccattgtatgacttagacgtcaacttgtatagaatc |
8049067 |
T |
 |
| Q |
238 |
accaaagctttggagtgcttagtttggtacttc |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
8049068 |
accaaagctttggagtgcttagtttggtacttc |
8049100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 207 - 258
Target Start/End: Complemental strand, 22991057 - 22991006
Alignment:
| Q |
207 |
gtctgacttagacctcaacttgtatagaataaccaaagctttggagtgctta |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
22991057 |
gtctgacttagacctcaacttgtatagaatcaccaaaactttggagtgctta |
22991006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University