View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8568_low_8 (Length: 246)
Name: NF8568_low_8
Description: NF8568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8568_low_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 24 - 225
Target Start/End: Complemental strand, 32346571 - 32346376
Alignment:
| Q |
24 |
gatacagaagagagaaaaaatttcaactgtaaacaatgctcgccgctgcttcgaggcacgccaggtacacacccggcagcaacaaccgtgtccggtcact |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
32346571 |
gatacagaagagagaaaaaatttcaactgtaaacaatgctcgccgctgcttcgaggcacgccaggtacacacccggccgcaacaaccgtgtccggtcact |
32346472 |
T |
|
| Q |
124 |
cttaaacgcttccggcatcaccaccggttactcaattcccacttcaaacggaatcagttacagttacagttacagttacagtaacctcaacaccagaact |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
32346471 |
cttaaacgcttccggcatcaccaccggttactcaattcccacttcaaatggaatcagttacagttacagtta------cagtaacctcaacaccagaact |
32346378 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University