View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8568_low_9 (Length: 242)
Name: NF8568_low_9
Description: NF8568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8568_low_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 25472769 - 25472993
Alignment:
| Q |
1 |
aaatgtatgcataattgtctcttaggcacggaacctgaaaattaaagaaaatgagaatacataacacatattaggattttgatgcattgcttcacaaacc |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25472769 |
aaatatatgcataattgtctcttaggcacggaacctgaaaattaaagaaaatgagaatacataacacatattaggattttgatgcattgcttcacaaacc |
25472868 |
T |
|
| Q |
101 |
tcttagctttagtaactgaacaaaagatctaattgcaccatgtaaatcataaaaaggaagaatagatcttctcaccaattcaatcattaacgaggaggaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
25472869 |
tcttagctttagtaactgaacaaaagatctaattgcaccatgtaaatcataaaaaggaagaatagatcctctcaccaattcaatcattaacgaggaggaa |
25472968 |
T |
|
| Q |
201 |
atattcactacactgcaaaactgat |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
25472969 |
atattcactacactgcaaaactgat |
25472993 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University