View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8569_high_11 (Length: 278)
Name: NF8569_high_11
Description: NF8569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8569_high_11 |
 | |
|
| [»] scaffold0003 (1 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 21 - 272
Target Start/End: Original strand, 27606325 - 27606579
Alignment:
| Q |
21 |
aatgcttttttcctccaaggatagt--gtttagtttaagaaacccatccaaccataaccgttttgaataat-tattaataaaagtacttacaatagcaac |
117 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
27606325 |
aatgcttttttcctgcaaggatagtacgtttagtttaagaaacccatccaaccatagccgttttgaataaaatattaataaaagtacttacaatagcaac |
27606424 |
T |
|
| Q |
118 |
aaacacaaaacatgtttcattatgaaaatttaaggttagaacaaactctgcccattcagcnnnnnnngaaacacatttgttcctccctataaagcttttg |
217 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
27606425 |
aaatacaaaacatgtttcattatgaaaatttaaggttagaacaaactctgcccattcagcaaaaaaagaaacacatttgttcctccctataaagcttttg |
27606524 |
T |
|
| Q |
218 |
ggagaggtaattcgaaatacaagtcctcaccagggcaggcatggataacacgaaa |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27606525 |
ggagaggtaattcgaaatacaagtcctcaccagggcaggcatggataacacgaaa |
27606579 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 43 - 84
Target Start/End: Original strand, 27418627 - 27418668
Alignment:
| Q |
43 |
agtgtttagtttaagaaacccatccaaccataaccgttttga |
84 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || |||||| |
|
|
| T |
27418627 |
agtgtttagtttaagaaacccatccaaccatagccattttga |
27418668 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 43 - 84
Target Start/End: Complemental strand, 68736 - 68695
Alignment:
| Q |
43 |
agtgtttagtttaagaaacccatccaaccataaccgttttga |
84 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || |||||| |
|
|
| T |
68736 |
agtgtttagtttaagaaacccatccaaccatagccattttga |
68695 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University