View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8569_low_14 (Length: 349)
Name: NF8569_low_14
Description: NF8569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8569_low_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 14 - 288
Target Start/End: Original strand, 5234186 - 5234461
Alignment:
| Q |
14 |
atcacaaatcaacaatgaagatttttaggaagaagatagtctatcaaaatacaagcattcgatcttagagtaagactgatttaccttaataggttttgga |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5234186 |
atcacaaatcaacaatgaagatttttaggaagaagatagtctatcaaaatacaagcattcgatcttagagtaagactgatttaccttaataggttttgga |
5234285 |
T |
 |
| Q |
114 |
tttcacaagttcttttttatgacgaaaaatggggttatccccaaggaaatcaaacaaagaaagctagaaaactttaacttgtgaaagcctc-ttttgttc |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
5234286 |
tttcacaagttcttttttatgacgaaaaatggggttaaccccaaggaaatcaaacaaagaaagctagaaaactttaacttgtgaaagcctctttttgttc |
5234385 |
T |
 |
| Q |
213 |
cctacttttatgaagtaagataattgctcaataggtctatcggagttgctcatcacattggatcgcaaatagacac |
288 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5234386 |
cctacttttacgaagtaagataattgctcaataggtctatcggagttgctcatcacattggatcgcaaatagacac |
5234461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University