View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8569_low_20 (Length: 305)
Name: NF8569_low_20
Description: NF8569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8569_low_20 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 3 - 305
Target Start/End: Complemental strand, 5129792 - 5129498
Alignment:
| Q |
3 |
aatatgactcttgacaggtaccctcctccggtgtgacttttgatgaaagagtacaactgaaatgaagcaacttccatacaataggtagggttatgaaagt |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5129792 |
aatatgactcttgacaggtaccctcctccggtgagacttttgatgaaagagtacaactgaaatgaagcaacttccatacaataggtagggttatgaaagt |
5129693 |
T |
 |
| Q |
103 |
tcttgttttaggatgcaaatgatgtcttttctttttattgtaaaatttaatctctgttcattagtcattatctatggttttcggagaatgacttgctacc |
202 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
5129692 |
tcttgttttaggatgaaaatgatgtcttttcttttt-ttgtaaactttaatctctgttcattagtcattatctatggttttcagagaatgacttgctacc |
5129594 |
T |
 |
| Q |
203 |
ttgttaccttcattaggaaaaacaagacagttctttatcattcagtttcctgatgtcttatatatgcttttcttcatctatcttgtcttcttagtcttta |
302 |
Q |
| |
|
||||| || | | || | |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5129593 |
ttgttgcc--gagtgcttaatgc---tcagt--tttatcattcagtttcctgatgtcttatatatgcttttcttcatctatcttgtcttcttagtcttta |
5129501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University