View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8569_low_29 (Length: 260)
Name: NF8569_low_29
Description: NF8569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8569_low_29 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 249
Target Start/End: Complemental strand, 12200974 - 12200727
Alignment:
| Q |
1 |
agaaaaaggaaaattgagtgatgagatttttgtgagtgatgtggtttaatggtgttgaatattgaggttgtgtgtgggggtttatgtagacactaagatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12200974 |
agaaaaaggaaaattgagtgatgagatttttgtgagtgttgtggtttaatggtgttgaatattgaggttgtgtgtgggggtttatgtagacactaagatg |
12200875 |
T |
 |
| Q |
101 |
gagtgtgtatggtttgtgaaagtgtgtgaactgttgtgtgtagcactggatctagctggaaattttggtggatcccactggattctactttgaaaatgat |
200 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12200874 |
gagtgtatatggtttgtgaaagagtgtgaactgtt-tgtgtagcactggatctagctggaaattttggtggatcccactggattctactttgaaaatgat |
12200776 |
T |
 |
| Q |
201 |
gttgaataagcacatatcacagtcatccggatcgataatatctgatgtc |
249 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |||||| |||||||| |
|
|
| T |
12200775 |
gttgaataagcacatatcatagtcatccggatctataataactgatgtc |
12200727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University