View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8569_low_31 (Length: 244)
Name: NF8569_low_31
Description: NF8569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8569_low_31 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 35841579 - 35841349
Alignment:
| Q |
1 |
ctgtagcatccggatcaataccttgagcagtcccattttggacaccatgtgttccggaagctttgtcgctgtcagaatcatcattggtatacaactgttc |
100 |
Q |
| |
|
||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
35841579 |
ctgtagcatcctgatcaataccttgagcagttccattttggacaccatgtgttccggaagctttgtcactgtcagaatcatcattggtatacaactgttc |
35841480 |
T |
 |
| Q |
101 |
accgccagtattagttcccgaactaacactagaaaccttgtgacttcctccaaacacaaaaacgttgctactacttacatgtgaactcgtagaatctcta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35841479 |
accgccagtattagttcccgaactaacactagaaaccttgtgacttcctccaaacacaaaaacgttgctactacttacatgtgaactcgtagaatctcta |
35841380 |
T |
 |
| Q |
201 |
gcaatacgaacaccctcgtgatcattgatgt |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
35841379 |
gcaatacgaacaccctcgtgatcattgatgt |
35841349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University