View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8569_low_35 (Length: 239)
Name: NF8569_low_35
Description: NF8569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8569_low_35 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 49496165 - 49495942
Alignment:
| Q |
1 |
attatcatattaatagagatttgtctcagtttaatttgttcatgtcaatcacctctacttat--tttttcagttttcacatccactttgtcaaagctacg |
98 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||| |
|
|
| T |
49496165 |
attatcatattaatatagatttgtctcagtttaatttgttcatgtcaatcacctctacttatattttttcagttttcacatccactt-gtcaaagctacg |
49496067 |
T |
 |
| Q |
99 |
agattatgtcacgacatgagaccataaataatagtaccccaattgaatcatatcatttccttggtttgtgtatttaattggaaaacagttactcataatt |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49496066 |
agattatgtcacgacatgagaccataaataatagtaccccaattgaatcatatcatttccttggtttgtgtatttaattggaaaacagttactcataatt |
49495967 |
T |
 |
| Q |
199 |
gttccatttctagttgtgttctgtc |
223 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
49495966 |
gttccatttctagttgtgttctgtc |
49495942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University