View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8570_high_14 (Length: 246)
Name: NF8570_high_14
Description: NF8570
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8570_high_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 3 - 229
Target Start/End: Original strand, 46294513 - 46294739
Alignment:
| Q |
3 |
catcaaattggagtgtctcacctttctttgtatagatattttagttcacacatacaattcagatacttgcatccttgctatttgggcttagagatttgat |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46294513 |
catcaaattggagtgtctcacctttctttgtatagatattttagttcacacatacaattcagatacttgcatccttgctatttgggcttagagatttgat |
46294612 |
T |
|
| Q |
103 |
ttgcataatggtttttgtgtaggtgggagtgaatattttgatggctcaagttggttgctttgttccatgtgacaaagcgagcatatctgttcgtgattgc |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46294613 |
ttgcataatggtttttgtgtaggtgggagtgaatattttgatggctcaagttggttgctttgttccatgtgacaaagcgagcatatctgttcgtgattgc |
46294712 |
T |
|
| Q |
203 |
atttttgctcgtgttggtgcaggtgat |
229 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
46294713 |
atttttgctcgtgttggtgcaggtgat |
46294739 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University