View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8570_high_16 (Length: 233)
Name: NF8570_high_16
Description: NF8570
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8570_high_16 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 19 - 216
Target Start/End: Complemental strand, 34201011 - 34200814
Alignment:
| Q |
19 |
cataatacccgcattgatggcatttctctcccttggttggatcatatatatggtccccatcctcatcatatccatccacatacaattcccaatcagtctc |
118 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
34201011 |
cataatacccgcattgatgacatttctctcccttggttggatcatatatatggtccccatcctcatcatatccatccacgtacaattcccaatcagtctc |
34200912 |
T |
|
| Q |
119 |
acaatctcctagcagcttctcatgctcttcagtgtaaacttccgggtttgtgccttctggtatatgaatttccacttccttccttttcttacttgatg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
34200911 |
acaatctcctagcagcttctcatgctcttcagtgtaaacttcagggtttgtgccttctggtatatgaatttctacttccttccttttcttacttgatg |
34200814 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 19 - 81
Target Start/End: Original strand, 32810654 - 32810716
Alignment:
| Q |
19 |
cataatacccgcattgatggcatttctctcccttggttggatcatatatatggtccccatcct |
81 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32810654 |
cataatacccgcattgatggcatttctctcccttggttggatcatatatatggtccccatcct |
32810716 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 55; Significance: 9e-23; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 19 - 81
Target Start/End: Complemental strand, 19886159 - 19886098
Alignment:
| Q |
19 |
cataatacccgcattgatggcatttctctcccttggttggatcatatatatggtccccatcct |
81 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
19886159 |
cataatacccgcattgatggcatttctctcccttggttggatcatata-atggtccccatcct |
19886098 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 55; Significance: 9e-23; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 19 - 81
Target Start/End: Original strand, 11494762 - 11494824
Alignment:
| Q |
19 |
cataatacccgcattgatggcatttctctcccttggttggatcatatatatggtccccatcct |
81 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
11494762 |
cataatacccgcattggtggcatttctctcccttggttggatcatatgtatggtccccatcct |
11494824 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University