View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8570_high_18 (Length: 209)
Name: NF8570_high_18
Description: NF8570
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8570_high_18 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 120; Significance: 1e-61; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 3 - 137
Target Start/End: Complemental strand, 30952949 - 30952817
Alignment:
| Q |
3 |
gattgaagcaatggagaacactcagaaagaagaatagcgttctgtgtttgatcctcccttcccttctatccatggtattaagtttgttagatgtgtgtgt |
102 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30952949 |
gattgaagcaatggagaacacccagaaagaagaatagcgtt--gtgtttgatcctcccttcccttctatccatggtattaagtttgttagatgtgtgtgt |
30952852 |
T |
|
| Q |
103 |
tgggtagcaagaaattagccacaaatgttgggtag |
137 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
30952851 |
tgggtagcaagaaattagccacaaatgttgggtag |
30952817 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University