View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8570_high_3 (Length: 360)
Name: NF8570_high_3
Description: NF8570
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8570_high_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 108; Significance: 4e-54; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 108; E-Value: 4e-54
Query Start/End: Original strand, 225 - 340
Target Start/End: Complemental strand, 40609451 - 40609336
Alignment:
| Q |
225 |
taacttaagaatcatcataatattgatagaaaatttatttaacaaagataaaatgaatttataattgttttagtctttgtcattagaagatgttgagtac |
324 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40609451 |
taacttaagaatcatcgtaatattgatagaaaacttatttaacaaagataaaatgaatttataattgttttagtctttgtcattagaagatgttgagtac |
40609352 |
T |
|
| Q |
325 |
tttcctaatatccttg |
340 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
40609351 |
tttcctaatatccttg |
40609336 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 126 - 181
Target Start/End: Complemental strand, 40609549 - 40609494
Alignment:
| Q |
126 |
ggtcggcaatactttatgtttcttatgtaggaaggaatagacaaaataacttgatt |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40609549 |
ggtcggcaatactttatgtttcttatgtaggaaggaatagacaaaataacttgatt |
40609494 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 17 - 70
Target Start/End: Complemental strand, 40609852 - 40609799
Alignment:
| Q |
17 |
acatataattaatcttttattggtttggaagcatattgaacatcattataatta |
70 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
40609852 |
acatataattaatcttttattggtttcgaagcatattgaacatcattataatta |
40609799 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University