View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8570_high_7 (Length: 321)
Name: NF8570_high_7
Description: NF8570
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8570_high_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 22 - 307
Target Start/End: Original strand, 44464878 - 44465163
Alignment:
| Q |
22 |
cccgtctcatattaagccttcgattttgtattgtttttccaaaatatataatctaattgaatttataactgcaggttatattatgtaatgactgtgaaaa |
121 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
44464878 |
cccgtctcatattaaaccttcgattttgtattgtttttccgaaatatataatctaattgaatttataactgcaggttattttatgtaatgactgtgaaaa |
44464977 |
T |
 |
| Q |
122 |
gaaaggagcagctcccttccactggctttaccacaaatgctcttgttgtggttcctataacactagagttatatgattcttccagtgtgagcatagatgt |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44464978 |
gaaaggagcagctcccttccactggctttaccacaaatgctcttgttgtggttcctataacactagagttatatgattcttccagtgtgagcatagatgt |
44465077 |
T |
 |
| Q |
222 |
ttgcctctcctagcttctctgtatttaagcattagatcatactttgtttttaagtttttagctctatcacttatgccagaataatc |
307 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
44465078 |
ttgcctctcccagcttctctgtatttaagcattagatcatactttgtttttaagtttttagctttatcacttatgccagaataatc |
44465163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University