View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8571_low_21 (Length: 308)
Name: NF8571_low_21
Description: NF8571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8571_low_21 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 175; Significance: 3e-94; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 7 - 185
Target Start/End: Original strand, 34089082 - 34089260
Alignment:
| Q |
7 |
gtagcagagacgatgatcagatgaatcattagaagcttaggtagcatctcattttcacacagtccgtttgcttttttgtgcatagaaagagaaggaagag |
106 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34089082 |
gtagcaaagacgatgatcagatgaatcattagaagcttaggtagcatctcattttcacacagtccgtttgcttttttgtgcatagaaagagaaggaagag |
34089181 |
T |
|
| Q |
107 |
agcaaaagccggaagaggtaaacaaagtagaacaactcaggtattgtattggcacatttctggatcctttgaattgaaa |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34089182 |
agcaaaagccggaagaggtaaacaaagtagaacaactcaggtattgtattggcacatttctggatcctttgaattgaaa |
34089260 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 235 - 290
Target Start/End: Original strand, 34089314 - 34089369
Alignment:
| Q |
235 |
cccattgatagagattatatgctcatcttttttgacacgacgcctttactagggtg |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34089314 |
cccattgatagagattatatgctcatcttttttgacacgacgcctttactagggtg |
34089369 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University