View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8571_low_25 (Length: 249)
Name: NF8571_low_25
Description: NF8571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8571_low_25 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 12 - 233
Target Start/End: Complemental strand, 45382700 - 45382479
Alignment:
| Q |
12 |
tcagtgcttcatagataatgaaaaatgagtggaaaaataaacttataaatcaggtatgaaataaacttacagccaaaccagattgtattctctcagcagt |
111 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45382700 |
tcagtgcttcatagataacgaaaaatgagtggaaaaataaacttataaatcaggtatgaaataaacttacagccaaaccagattgtattctctcagcagt |
45382601 |
T |
|
| Q |
112 |
gtcatcagtgagcttgtctatcttttcacaatctctttcttcactagctacagcaatcttatgaaggtaaaaaggagtaagctcttttctaacttcttca |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45382600 |
gtcatcagtgagcttgtctatcttttcacaatctctttcttcactagctacagcaatcttatgaaggtaaaaaggagtaagctcttttctaacttcttca |
45382501 |
T |
|
| Q |
212 |
ggtatctttgatagtcttcttg |
233 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
45382500 |
ggtatctttgatagtcttcttg |
45382479 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University