View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8571_low_29 (Length: 232)
Name: NF8571_low_29
Description: NF8571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8571_low_29 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 15 - 211
Target Start/End: Original strand, 42589900 - 42590096
Alignment:
| Q |
15 |
cagagaccacctttagtatgtgtgcaatcaatttgagtcatagaaaattttacttttgttgatacattactatcttcaaccacaaattcaccggcatggt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
42589900 |
cagagaccacctttagtatgtgtgcaatcaatttgagtcatagaaaattttacttttgttgatacattactatcttcaaccacaaaatcaccggcatggt |
42589999 |
T |
|
| Q |
115 |
aatagcgccatttacctggacctttcaaaaaacattgcgacgaatcatattgatcatctgaagtccatagctggaatctaacaggctttacatccca |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42590000 |
aatagcgccatttacctggacctttcaaaaaacattgcgatgaatcatattgatcatctgaagtccatagctggaatctaacaggctttacatccca |
42590096 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 18 - 77
Target Start/End: Complemental strand, 2975692 - 2975633
Alignment:
| Q |
18 |
agaccacctttagtatgtgtgcaatcaatttgagtcatagaaaattttacttttgttgat |
77 |
Q |
| |
|
|||||||||||||| || ||||||||||||||||||||||| ||||| ||||| |||||| |
|
|
| T |
2975692 |
agaccacctttagtgtgcgtgcaatcaatttgagtcatagagaatttgactttggttgat |
2975633 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University