View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8573_low_8 (Length: 281)

Name: NF8573_low_8
Description: NF8573
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8573_low_8
NF8573_low_8
[»] chr8 (1 HSPs)
chr8 (14-264)||(30148318-30148568)
[»] scaffold0009 (1 HSPs)
scaffold0009 (15-256)||(141069-141310)


Alignment Details
Target: chr8 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 14 - 264
Target Start/End: Original strand, 30148318 - 30148568
Alignment:
14 ggtgttgtatgtttgttttgggagtcagaagctacttaaaaaggaacagatggaggcgttggcattcgggttggagaggtctgggacaccatttgtttgg 113  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30148318 ggtgttgtatgtttgttttgggagtcagaagctacttaaaaaggaacagatggaggcgttggcattcgggttggagaggtctgggacaccatttgtttgg 30148417  T
114 gtggtcaaagagccttccacggcagagcagttggaggaaggttatggattggtgccggaggggtttgaggatcgtgtttcgggtagggggattgtggtga 213  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
30148418 gtggtcaaagagccttccacggcagagcagttggaggaaggttatggattggtgccggaggggtttgaggattgtgtttcgggtagggggattgtggtga 30148517  T
214 ggggttgggcaccacaaatggcgatattgggtcatcggattgttggcgggt 264  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||    
30148518 ggggttgggcaccacaaatggcgatattgggtcatcggattgttggcgggt 30148568  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0009 (Bit Score: 106; Significance: 4e-53; HSPs: 1)
Name: scaffold0009
Description:

Target: scaffold0009; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 15 - 256
Target Start/End: Complemental strand, 141310 - 141069
Alignment:
15 gtgttgtatgtttgttttgggagtcagaagctacttaaaaaggaacagatggaggcgttggcattcgggttggagaggtctgggacaccatttgtttggg 114  Q
    |||||||||||||||||||||||||||||| || | | || ||| || |||||||| ||||||||||||||||| || || ||||  | |||||||||||    
141310 gtgttgtatgtttgttttgggagtcagaagttaatgagaagggatcaaatggaggcattggcattcgggttggaaagatccgggatccgatttgtttggg 141211  T
115 tggtcaaagagccttccacggcagagcagttggaggaaggttatggattggtgccggaggggtttgaggatcgtgtttcgggtagggggattgtggtgag 214  Q
    |||| || |  || || ||||  |||||  | ||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||     
141210 tggtgaaggttccgtcgacggtggagcaaatagaggaaggttatggattggtgccggaggggtttgaggattgggtttcgggtagggggattgtggtgaa 141111  T
215 gggttgggcaccacaaatggcgatattgggtcatcggattgt 256  Q
    ||||||||  ||||| || |||||||| ||||||||| ||||    
141110 gggttgggtcccacagatagcgatattaggtcatcgggttgt 141069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University