View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8573_low_9 (Length: 252)
Name: NF8573_low_9
Description: NF8573
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8573_low_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 9 - 239
Target Start/End: Original strand, 38932520 - 38932753
Alignment:
| Q |
9 |
cagagacaccaacacaacgtagctcagggtgattagcatcccatgtttcagtcagacctgcttctgactcaatgcggttgtcaggttccaatgcatcgat |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
38932520 |
cagagacaccaacacaacgtagctcagggtgattagcatcccatgtttcagtcagacctgcttctgactcaatgctgttgtcaggttccaatgcatcgat |
38932619 |
T |
 |
| Q |
109 |
gctatctagttggcacgactcaatttgatgacgtggtggaagctgtcgtgctgaacataagaagagtaacaaacaaagtgtgatcagaagagattttgtc |
208 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38932620 |
gctatctagttggcacgactcactttgatgacgtggtggaagctgtcgtgctgaacagaagaagagtaacaaacaaagtgtgatcagaagagattttgtc |
38932719 |
T |
 |
| Q |
209 |
tttgccatgatagctg---aactgtggagattgt |
239 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |
|
|
| T |
38932720 |
tttgccatgctagctgaacaactgtggagattgt |
38932753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University