View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8574_high_2 (Length: 250)
Name: NF8574_high_2
Description: NF8574
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8574_high_2 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 15 - 250
Target Start/End: Complemental strand, 55505890 - 55505655
Alignment:
| Q |
15 |
tctctacaagaaagatcaaagatggaacggagaaaacttggatcctcccattttctttagcaacaagacattgtaacattcaaagagagtaagacatgat |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55505890 |
tctctacaagaaagatcaaagatggaacggagaaaacttggatcctcccattttctttagcaacaagacattgtaacattcaaagagagtaagacatgat |
55505791 |
T |
 |
| Q |
115 |
tttaaaacccttgcactagaaatgatgaatccaagtacagtagaacatgtagttttgtctccaaacatgataccttcatctccccacaaggaaaaggaga |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55505790 |
tttaaaacccttgcactagaaatgatgaatccaagtacactagaacatgtagttttgtctccaaacatgataccttcatctccccacaaggaaaaggaga |
55505691 |
T |
 |
| Q |
215 |
ggatctgaaccctcataatttatggattatcattgc |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
55505690 |
ggatctgaaccctcataatttatggattatcattgc |
55505655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 103; Significance: 2e-51; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 132 - 246
Target Start/End: Complemental strand, 43996037 - 43995923
Alignment:
| Q |
132 |
agaaatgatgaatccaagtacagtagaacatgtagttttgtctccaaacatgataccttcatctccccacaaggaaaaggagaggatctgaaccctcata |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
43996037 |
agaaatgatgaatccaagtacagtagaacatgtagttttgtctccaaacatgataccttcatctccccacaaggaaaaggagaggatccaaaccctcata |
43995938 |
T |
 |
| Q |
232 |
atttatggattatca |
246 |
Q |
| |
|
|| |||||||||||| |
|
|
| T |
43995937 |
atctatggattatca |
43995923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 132 - 203
Target Start/End: Original strand, 43633890 - 43633961
Alignment:
| Q |
132 |
agaaatgatgaatccaagtacagtagaacatgtagttttgtctccaaacatgataccttcatctccccacaa |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43633890 |
agaaatgatgaatccaagtacagtagaacatgtagttttgtctccaaacatgataccttcatctccccacaa |
43633961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University