View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8574_low_11 (Length: 222)
Name: NF8574_low_11
Description: NF8574
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8574_low_11 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 30000892 - 30001113
Alignment:
| Q |
1 |
tgaggcttttgagttctagttggttgcattcagttgttaataggaagaatcttagttctacatctttgaaccaaggaaaagttgagaggatggaagtgga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30000892 |
tgaggcttttgagttctagttggttgcattcagttgttaataggaagaatcttagttctacatctttgaaccaaggaaaagttgagaggatggaagtgga |
30000991 |
T |
 |
| Q |
101 |
atcatctgatattgtgagaaatgttggtttggatgttgtttcggattcggataggcgtgatacaggttgttgtgcaattggttcaagggatcatgaagtg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
30000992 |
atcatctgatattgtgagaaatgttggtttggatgttgtttcggattcggatagacatgatacgggttgttgtgcaattggttcaagggatcatgaagtg |
30001091 |
T |
 |
| Q |
201 |
gaggatgagtatcaattaaaat |
222 |
Q |
| |
|
||||| |||||||||||||||| |
|
|
| T |
30001092 |
gaggaagagtatcaattaaaat |
30001113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University