View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8574_low_6 (Length: 297)
Name: NF8574_low_6
Description: NF8574
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8574_low_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 1 - 280
Target Start/End: Complemental strand, 43740801 - 43740522
Alignment:
| Q |
1 |
agactaacaggggatttcataacgtcgagtgagattgggcatttgaagaaggtgggaacagtgatgcatagatcaacaactctttctctaaccatggtgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43740801 |
agactaacaggggatttcataacgtcgagtgagattgggcatttgaagaaggtgggaacagtgatgcatagatcaacaactctttctctaaccatggtgg |
43740702 |
T |
|
| Q |
101 |
tggatgaaagtggaaaaagagaaaggaataaaacaaaaagtgatattgagttgagaggactaagaggagagttgagctgagttatgtggaaatggaaggg |
200 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
43740701 |
tggatgaaagtggaaaaagagaatggaataaaacaaaaagtgatattgagttgagaggactaagaggagagttgaggtgagttatgtggaaatggaaggg |
43740602 |
T |
|
| Q |
201 |
gatatagagagagagattgatggggagagtcaaaggtgggtgacgtaagatgctttctccatttgctttgccattataat |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
43740601 |
gatatagagagagagattgatggggagagtcaaaggtgggtgacgtaagatgctttctccatttgcttttccattataat |
43740522 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University