View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8575_high_12 (Length: 259)
Name: NF8575_high_12
Description: NF8575
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8575_high_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 1 - 245
Target Start/End: Complemental strand, 53248947 - 53248703
Alignment:
| Q |
1 |
ttttactaggctaaattgatttaaaattaaatgttaaatgctgaannnnnnnccataaaagagaaaggaaagaaatatatgatatactgatatagtcgac |
100 |
Q |
| |
|
|||||| ||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53248947 |
ttttaccaggctaa-ttgatttaaaattaaatgttaaatgctgaatttttttccataaaagagaaaggaaagaaatatatgatatactgatatagtcgac |
53248849 |
T |
 |
| Q |
101 |
tt-cnnnnnnnnnnnnnnatctttctgttaatgtacacactactgattattttgcattgaggtggcctgtaaaattgtagttgccccctccnnnnnnnnn |
199 |
Q |
| |
|
|| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
53248848 |
tttctttttcgtttttttatctttctgttaatgtacacactactgattattttgcattgaggtggcctgtaaaattgtagttgcctcctccttttttttt |
53248749 |
T |
 |
| Q |
200 |
gctcaaccaagtgagctacccatcccccctcccaaaattgttgctc |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
53248748 |
gctcaaccaagtgagctacccatcccccctcccaaaatagttgctc |
53248703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University