View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8575_low_20 (Length: 276)
Name: NF8575_low_20
Description: NF8575
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8575_low_20 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 12 - 256
Target Start/End: Complemental strand, 8124692 - 8124448
Alignment:
| Q |
12 |
tcatcaaaaaaggtctgaactttaagctctagagttaaagtgttatagcttgccttaatatcacagccatgagaaaggtaagggctggaacagaattttg |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8124692 |
tcatcaaaaaaggtctgaactttaagctctagagttaaagtgttatagcttgccttaatatcacagccatgagaaaggtaagggctggaacagaattttg |
8124593 |
T |
 |
| Q |
112 |
catagcagaagcaaatgttggtgatgtgttgtccaaacccaaaaggtaaaatccttctttcattgttattctgtcagaaggtatcatttcaagttacaga |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
8124592 |
catagcagaagcaaatgttggtgatgtgttgtccaaacccaaaaggtaaaatccttctttcattgttattctgtcagaaggtatcatttcaagttacaca |
8124493 |
T |
 |
| Q |
212 |
atcatgttttttattaatttagtacatgtctgaattgacggcgat |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8124492 |
atcatgttttttattaatttagtacatgtctgaattgacggcgat |
8124448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 77 - 147
Target Start/End: Original strand, 52730445 - 52730515
Alignment:
| Q |
77 |
gccatgagaaaggtaagggctggaacagaattttgcatagcagaagcaaatgttggtgatgtgttgtccaa |
147 |
Q |
| |
|
||||||| ||| |||| |||||| |||||||| || ||||| || ||||| ||||| |||||||||||||| |
|
|
| T |
52730445 |
gccatgacaaatgtaatggctggtacagaattctgtatagctgatgcaaaggttggagatgtgttgtccaa |
52730515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University