View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8575_low_21 (Length: 266)
Name: NF8575_low_21
Description: NF8575
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8575_low_21 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 1 - 266
Target Start/End: Original strand, 15288299 - 15288567
Alignment:
| Q |
1 |
cactctctttgattgtgccacatgtggtgacattgtatatagggcctctcatgtcactaacccaatctccatttgaatagtcacatgatttctcatgatc |
100 |
Q |
| |
|
|||| ||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15288299 |
cactttctttgattgtaccacatgtggtgacattgtataaagggcctctcatgtcactaacccaatctccatttgaatagtcacatgatttctcatgatc |
15288398 |
T |
|
| Q |
101 |
ataaaccttgttcttccctacaaaaaatatattacataaaaattagtaaactaagaagtccttaattagtataacaaattgctagttagagttcatgaca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15288399 |
ataaaccttgttcttccctacaaaaaatatattacataaaaattagtaaactaagaagtccttaattagtataacaaattgctagttagagttcatgaca |
15288498 |
T |
|
| Q |
201 |
atctcaactagcatgatatttaaaagaac---ttaattatgcatgcatatttacctacaaaagaagttg |
266 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15288499 |
atctcaactagcatgatatttaaaagaactaattaattatgcatgcatatttacctacaaaagaagttg |
15288567 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University