View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8575_low_27 (Length: 239)
Name: NF8575_low_27
Description: NF8575
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8575_low_27 |
 |  |
|
| [»] chr8 (2 HSPs) |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 106; Significance: 4e-53; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 126 - 239
Target Start/End: Original strand, 12521242 - 12521355
Alignment:
| Q |
126 |
cattaccagcaatttttatttcaaactctttatcgctttgttttggttccttcatttacttttatgtcatttactttcatgtctttatcttataatcctt |
225 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12521242 |
catttccagcaatttttatttcaaactctttatcgctttgttttcgttccttcatttacttttatgtcatttactttcatgtctttatcttataatcctt |
12521341 |
T |
 |
| Q |
226 |
tgtatattatgatc |
239 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
12521342 |
tgtatattatgatc |
12521355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 18 - 56
Target Start/End: Original strand, 12521137 - 12521175
Alignment:
| Q |
18 |
acttgtaatcttactccaaagttgaaatcaagttcctat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12521137 |
acttgtaatcttactccaaagttgaaatcaagttcctat |
12521175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 37; Significance: 0.000000000005; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 152 - 216
Target Start/End: Complemental strand, 31974383 - 31974319
Alignment:
| Q |
152 |
tctttatcgctttgttttggttccttcatttacttttatgtcatttactttcatgtctttatctt |
216 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||||| ||||||||||| ||||||| ||||| |
|
|
| T |
31974383 |
tctttatcgctttgttttcattctgtcatttacttttatatcatttacttttatgtcttcatctt |
31974319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 18 - 51
Target Start/End: Complemental strand, 31974514 - 31974481
Alignment:
| Q |
18 |
acttgtaatcttactccaaagttgaaatcaagtt |
51 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |
|
|
| T |
31974514 |
acttgtaatcctactccaaagttgaaatcaagtt |
31974481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 152 - 192
Target Start/End: Complemental strand, 41700335 - 41700295
Alignment:
| Q |
152 |
tctttatcgctttgttttggttccttcatttacttttatgt |
192 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
41700335 |
tctttatcgctttgttttcattccttcatttacttttatgt |
41700295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 177 - 228
Target Start/End: Original strand, 10234631 - 10234682
Alignment:
| Q |
177 |
tcatttacttttatgtcatttactttcatgtctttatcttataatcctttgt |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| || |||||| |||| |
|
|
| T |
10234631 |
tcatttacttttatgtcatttactttcatgcatttattttctaatcccttgt |
10234682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 177 - 213
Target Start/End: Original strand, 12881039 - 12881075
Alignment:
| Q |
177 |
tcatttacttttatgtcatttactttcatgtctttat |
213 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
12881039 |
tcatttacttttatgccttttactttcatgtctttat |
12881075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 191 - 239
Target Start/End: Original strand, 37627429 - 37627477
Alignment:
| Q |
191 |
gtcatttactttcatgtctttatcttataatcctttgtatattatgatc |
239 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |||| || ||||||| |
|
|
| T |
37627429 |
gtcatttactttcatgtctttatcttttaatctcttgtctactatgatc |
37627477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University