View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8575_low_29 (Length: 238)
Name: NF8575_low_29
Description: NF8575
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8575_low_29 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 152; Significance: 1e-80; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 1 - 164
Target Start/End: Complemental strand, 19116290 - 19116127
Alignment:
| Q |
1 |
ctaatttattgaactgttttgtactaatgtttctctcagtgtcccttcacactaattcaaactatgtatatgtaaaatagggtctatcttatcatttttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
19116290 |
ctaatttattgaactgttttgtactaatgtttctctcagtgtcccttcacacaaattcaaactatgtacatgtaaaacagggtctatcttatcatttttg |
19116191 |
T |
|
| Q |
101 |
gtgtcatggcgaaccaataaaatggtgtccttgtaactatttaaaactagatataatctcgtgc |
164 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19116190 |
gtgtcatggcgaaccaataaaatggtgtccttgtaactatttaaaactagatataatctcgtgc |
19116127 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 184 - 222
Target Start/End: Complemental strand, 19113562 - 19113524
Alignment:
| Q |
184 |
gatattaatgtttgtgaccttaacagaacacctccaaag |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19113562 |
gatattaatgtttgtgaccttaacagaacacctccaaag |
19113524 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University