View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8576_high_11 (Length: 220)
Name: NF8576_high_11
Description: NF8576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8576_high_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 100; Significance: 1e-49; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 65 - 180
Target Start/End: Complemental strand, 7322039 - 7321924
Alignment:
| Q |
65 |
atttgtgaggataatcgaggttctggtttgccatttagggatgacttcctgaatttgttctggtttgcaatttagtaagtgtattatagattatgttttt |
164 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||| |
|
|
| T |
7322039 |
atttgtgaggataatcgaggttctggtttgccatttagggaggacttcctgaatttgttctggtttgcaatttagtatgtgtattatagattatgtgttt |
7321940 |
T |
 |
| Q |
165 |
cacatataatttagtt |
180 |
Q |
| |
|
| |||||||||||||| |
|
|
| T |
7321939 |
cgcatataatttagtt |
7321924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 21 - 65
Target Start/End: Complemental strand, 7322103 - 7322059
Alignment:
| Q |
21 |
ctatgtctctagagatgcaaataaagttgcagacaatttagccaa |
65 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
7322103 |
ctatgtctctagagatgcaactaaagttgcagacaatttagccaa |
7322059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University